Top » Catalog » SNPs » FTB87129

$18.00

FTB87129
[FTB87129]

FTB87129
hg38 Position: ChrY:4713502..4713502
Ancestral: T
Derived: A
Reference: FTDNA (2022)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FTB87129_F TGTTGGTTTTTGGTGAGATGAC
Reverse Primer: FTB87129_R CCTTCAAGATGGAACAAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies