Top » Catalog » SNPs » FGC67924

$18.00

FGC67924
[FGC67924]

FGC67924
hg38 Position: ChrY:12293854..12293854
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1707 > FGC5 > FGC67918
Forward Primer: FGC67924_F CATGTGATTATGGATGTGATTGG
Reverse Primer: FGC67924_R CCAAGGAGTTCAAGACCAGGA
Reviews

Customers who bought this product also purchased
ZS7093
ZS7093
FGC93790
FGC93790
A30104
A30104
FGC6770
FGC6770
ZS8349
ZS8349
ZS4276
ZS4276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies