Top » Catalog » SNPs » FGC67924

$18.00

FGC67924
[FGC67924]

FGC67924
hg38 Position: ChrY:12293854..12293854
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1707 > FGC5 > FGC67918
Forward Primer: FGC67924_F CATGTGATTATGGATGTGATTGG
Reverse Primer: FGC67924_R CCAAGGAGTTCAAGACCAGGA
Reviews

Customers who bought this product also purchased
FGC5441
FGC5441
ZS4775
ZS4775
FT375962
FT375962
ZS8321
ZS8321
FT293742
FT293742
FGC67372
FGC67372
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies