Top » Catalog » SNPs » FGC67924

$18.00

FGC67924
[FGC67924]

FGC67924
hg38 Position: ChrY:12293854..12293854
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1707 > FGC5 > FGC67918
Forward Primer: FGC67924_F CATGTGATTATGGATGTGATTGG
Reverse Primer: FGC67924_R CCAAGGAGTTCAAGACCAGGA
Reviews

Customers who bought this product also purchased
ZS10686
ZS10686
ZS10638
ZS10638
FGC4474
FGC4474
A27198
A27198
FGC45019
FGC45019
FGC41256
FGC41256
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies