Top » Catalog » SNPs » FT375719

$18.00

FT375719
[FT375719]

FT375719
hg38 Position: ChrY:14750181..14750181
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT375719_F TTTTGCCAGTTCTACCATTTCC
Reverse Primer: FT375719_R ACCAATTAACCTTATGCATCTATTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies