Top » Catalog » SNPs » Y31877

$18.00

Y31877
[Y31877]

Y31877
hg38 Position: ChrY:7315969..7315969
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below L2 > Z34 > BY3604
Forward Primer: Y31877_F CCAGGTAACCTCCCGCATAC
Reverse Primer: Y31877_R GACATGATACATCCATGTACCAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies