Top » Catalog » SNPs » BY169726

$18.00

BY169726
[BY169726]

BY169726
hg38 Position: ChrY:9607422..9607422
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY169726_F CTCCTGTACTCCCAAGCACTTTC
Reverse Primer: BY169726_R AATAGGGAACTGTTATTTCACAGCTC
Reviews

Customers who bought this product also purchased
BY170153
BY170153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies