Top » Catalog » SNPs » A32371

$18.00

A32371
[A32371]

A32371
hg38 Position: ChrY:7137354..7137354
Ancestral: G
Derived: A
Reference: YSEQ (2022)
ISOGG Haplogroup: J1
Comments: Below FGC1707 > ZS10558
Forward Primer: A32371_F CTATCCTAAATATACATGCACCCAATATG
Reverse Primer: A32371_R CATTTAGTGTTATAAATTTCCCTCTATACACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies