Top » Catalog » SNPs » A32373

$18.00

A32373
[A32373]

A32373
hg38 Position: ChrY:8824643..8824643
Ancestral: A
Derived: G
Reference: YSEQ (2022)
ISOGG Haplogroup: J1
Comments: Below FGC1707 > ZS10558
Forward Primer: A32373_F CTCCACCTTATAAAGCCTGCAG
Reverse Primer: A32373_R GCACCATCCTCCAGACCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y170456
1 x Y33800
$36.00
Haplogroup Info
Other products
Currencies