Top » Catalog » SNPs » FTB81391

$18.00

FTB81391
[FTB81391]

FTB81391
hg38 Position: ChrY:13355178..13355178
Ancestral: T
Derived: G
Reference: FTDNA (2022)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FTB81391_F TCTGTGCTGCTGTTCAGGTC
Reverse Primer: FTB81391_R GCAGCTTTATTTTGCCCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies