Top » Catalog » SNPs » BY16767

$18.00

BY16767
[BY16767]

BY16767
hg38 Position: ChrY:12126946..12126946
Ancestral: A
Derived: T
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF21 > L130
Forward Primer: BY16767_F GAGGGGGTAAGGATAGCACC
Reverse Primer: BY16767_R TTTTAATTCTTGGAGGCTGTGG
Reviews

Customers who bought this product also purchased
FT202854
FT202854
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies