Top » Catalog » SNPs » FT202854

$18.00

FT202854
[FT202854]

FT202854
hg38 Position: ChrY:26634082..26634082
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below DF21 > L130
Forward Primer: FT202854_F GTCAGGTTTTACAAAAATATATAAGGACC
Reverse Primer: FT202854_R TCATCATCAGTGTCTTGCACAC
Reviews

Customers who bought this product also purchased
BY16767
BY16767
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies