Top » Catalog » SNPs » CTS214

$18.00

CTS214
[CTS214]

CTS214
hg38 Position: ChrY:2948268..2948268
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a
Comments: Below Z92 > CTS9551
Forward Primer: CTS214_F CTTTTGTTTTCCTCTGCAACC
Reverse Primer: CTS214_R TCAAAGCACTGGATGTTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies