Top » Catalog » SNPs » FGC36928

$18.00

FGC36928
[FGC36928]

FGC36928
hg38 Position: ChrY:14125810..14125810
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > S7364 > FT76317
Forward Primer: FGC36928_F AAAGAGGTGGTAGAAATGTGTAAGTG
Reverse Primer: FGC36928_R CAGACAATGTTATCTATTCTCACAGTCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies