Top » Catalog » SNPs » FGC36929

$18.00

FGC36929
[FGC36929]

FGC36929
hg38 Position: ChrY:21070065..21070065
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > S7364 > FT76317
Forward Primer: FGC36929_F ACTTTAACATACTTGATAGGCTTCCC
Reverse Primer: FGC36929_R CAATTTACCCCCATCACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies