Top » Catalog » SNPs » Y227096

$18.00

Y227096
[Y227096]

Y227096
hg38 Position: ChrY:22216227..22216227
Ancestral: A
Derived: T
Reference: YFull (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y227096_F GCACTGGTACATTAAAATTTGTCAG
Reverse Primer: Y227096_R GGTGACACATGGTCATTTCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies