Top » Catalog » SNPs » Y329174

$18.00

Y329174
[Y329174]

Y329174
hg38 Position: ChrY:8102646..8102646
Ancestral: T
Derived: C
Reference: YFull (2022)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y189944 > Y329074
Forward Primer: Y329174_F TGAGGCTCCTTTGGTGTGC
Reverse Primer: Y329174_R GAGAGACCTTAAATGACATTTCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies