Top » Catalog » SNPs » A34088

$18.00

A34088
[A34088]

A34088
hg38 Position: ChrY:11937882..11937882
Ancestral: C
Derived: A
Reference: YSEQ (2022)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y52621 > FT190799 > Y189944
Forward Primer: A34088_F AAAAAACACATGAAAAAATGCTTG
Reverse Primer: A34088_R ATTCCCACCTATGAGTGAGAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies