Top » Catalog » SNPs » FGC17866

$18.00

FGC17866
[FGC17866]

FGC17866
hg38 Position: ChrY:17044794..17044794
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17907
Forward Primer: FGC17866_F AGGATGGGTGCTATGCATG
Reverse Primer: FGC17866_R CTCTGAGAAACTTCATATTTCTCTGC
Reviews

Customers who bought this product also purchased
FGC17897
FGC17897
FGC17898
FGC17898
FGC19454
FGC19454
S1050
S1050
DF41
DF41
Z16500
Z16500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies