Top » Catalog » SNPs » FGC17866

$18.00

FGC17866
[FGC17866]

FGC17866
hg38 Position: ChrY:17044794..17044794
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17907
Forward Primer: FGC17866_F AGGATGGGTGCTATGCATG
Reverse Primer: FGC17866_R CTCTGAGAAACTTCATATTTCTCTGC
Reviews

Customers who bought this product also purchased
S1051
S1051
FGC17906
FGC17906
DF13
DF13
Z251
Z251
R1b-S1051 Panel
R1b-S1051 Panel
DYS490
DYS490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies