Top » Catalog » SNPs » FGC17866

$18.00

FGC17866
[FGC17866]

FGC17866
hg38 Position: ChrY:17044794..17044794
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17907
Forward Primer: FGC17866_F AGGATGGGTGCTATGCATG
Reverse Primer: FGC17866_R CTCTGAGAAACTTCATATTTCTCTGC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
CTS1751
CTS1751
FGC17938
FGC17938
DF49
DF49
S1051
S1051
FGC17906
FGC17906
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies