Top » Catalog » SNPs » TY270187

$18.00

TY270187
[TY270187]

TY270187
hg38 Position: ChrY:7529461..7529461
Ancestral: C
Derived: T
Reference: TheYTree (2022)
ISOGG Haplogroup: E1b
Comments: Below M81 > Z5009 > FT31300
Forward Primer: TY270187_F CTCATGTGAACTTCCAACATGTC
Reverse Primer: TY270187_R TGGAACGCTAAGCATAAATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies