Top » Catalog » SNPs » YP108

$18.00

YP108
[YP108]

YP108
hg38 Position: ChrY:15943604..15943604
Ancestral: T
Derived: G
Reference: Francalacci (2013)
ISOGG Haplogroup: J2b
Comments: Below M102 > M205 > CTS1969
Forward Primer: YP108_F AGCTATTATTATTTTGAGATACGTTCCAC
Reverse Primer: YP108_R GAAATAAAAACTACCATCAGAGAATATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies