Top » Catalog » SNPs » BY197482

$18.00

BY197482
[BY197482]

BY197482
hg38 Position: ChrY:15255309..15255309
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY197482_F CCCTGTCCTGTTCTGTGCTG
Reverse Primer: BY197482_R AAATTGTGGGGGATCTAAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies