Top » Catalog » SNPs » Y221019

$18.00

Y221019
[Y221019]

Y221019
hg38 Position: ChrY:14594747..14594747
Ancestral: G
Derived: A
Reference: YFull (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y221019_F TATTGGACAATCTTTTTTAAAATGTCG
Reverse Primer: Y221019_R GGAGTTTGGAGATACCTGGTGTCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies