Top » Catalog » SNPs » Y197056

$19.00

Y197056
[Y197056]

Y197056
hg38 Position: ChrY:19985857..19985857
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Within DYS714 repeat
Forward Primer: Y197056_F CTCAGGTTGCGAAGACCG
Reverse Primer: Y197056_R GTATCAAATTTCTGGGTGGGC
Reviews

Customers who bought this product also purchased
FT259660
FT259660
Y164385
Y164385
Y164342
Y164342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies