Top » Catalog » SNPs » FT378591

$19.00

FT378591
[FT378591]

FT378591
hg38 Position: ChrY:21251830..21251830
Ancestral: T
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z3004 > FT90676
Forward Primer: FT378591_F GCAGAGATTGGTTCCTGGC
Reverse Primer: FT378591_R GCATATTGCTGTACTTTTCTGTGC
Reviews

Customers who bought this product also purchased
FT377556
FT377556
BY62271
BY62271
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies