Top » Catalog » SNPs » A35028

$18.00

A35028
[A35028]

A35028
hg38 Position: ChrY:20648283..20648283
Ancestral: G
Derived: A
Reference: YSEQ (2022)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A35028_F AACACTGGGGGAAAATACATAAAAG
Reverse Primer: A35028_R GATCTCGGGGAAGCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies