Top » Catalog » SNPs » PF4664

$19.00

PF4664
[PF4664]

PF4664
hg38 Position: ChrY:8552951..8552951
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: PF4664_F ACACCCTGTTCTCGTGTTCC
Reverse Primer: PF4664_R AGCTGTCTCCCCTTATCGTTTG
Reviews

Customers who bought this product also purchased
V1924
V1924
S11435
S11435
Y12883
Y12883
FGC1
FGC1
BY145
BY145
J1-FGC5 Panel
J1-FGC5 Panel
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies