Top » Catalog » SNPs » PF4664

$19.00

PF4664
[PF4664]

PF4664
hg38 Position: ChrY:8552951..8552951
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: PF4664_F ACACCCTGTTCTCGTGTTCC
Reverse Primer: PF4664_R AGCTGTCTCCCCTTATCGTTTG
Reviews

Customers who bought this product also purchased
J1-FGC5 Panel
J1-FGC5 Panel
FGC4474
FGC4474
FGC5427
FGC5427
ZS5631
ZS5631
FGC2
FGC2
Y12364
Y12364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies