Top » Catalog » SNPs » PF4664

$19.00

PF4664
[PF4664]

PF4664
hg38 Position: ChrY:8552951..8552951
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: PF4664_F ACACCCTGTTCTCGTGTTCC
Reverse Primer: PF4664_R AGCTGTCTCCCCTTATCGTTTG
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
ZS5631
ZS5631
FGC2
FGC2
Y12364
Y12364
FGC7393
FGC7393
Y12883
Y12883
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies