Top » Catalog » SNPs » FGC17898

$18.00

FGC17898
[FGC17898]

FGC17898
hg38 Position: ChrY:15986332..15986332
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17898_F GAAACTCCTAAACTCAAGTGACCTC
Reverse Primer: FGC17898_R TTAAAGGCTCTAATAGGGCAACC
Reviews

Customers who bought this product also purchased
FGC19454
FGC19454
Z39589
Z39589
S1051
S1051
FGC17907
FGC17907
DF13
DF13
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies