Top » Catalog » SNPs » FGC17898

$18.00

FGC17898
[FGC17898]

FGC17898
hg38 Position: ChrY:15986332..15986332
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17898_F GAAACTCCTAAACTCAAGTGACCTC
Reverse Primer: FGC17898_R TTAAAGGCTCTAATAGGGCAACC
Reviews

Customers who bought this product also purchased
S1050
S1050
FGC17897
FGC17897
L1335
L1335
FGC17938
FGC17938
FGC17866
FGC17866
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies