Top » Catalog » SNPs » FGC17898

$18.00

FGC17898
[FGC17898]

FGC17898
hg38 Position: ChrY:15986332..15986332
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17898_F GAAACTCCTAAACTCAAGTGACCTC
Reverse Primer: FGC17898_R TTAAAGGCTCTAATAGGGCAACC
Reviews

Customers who bought this product also purchased
R1b-S1051 Panel
R1b-S1051 Panel
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF41
DF41
S1050
S1050
FGC17897
FGC17897
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies