Top » Catalog » SNPs » FGC17906

$18.00

FGC17906
[FGC17906]

FGC17906
hg38 Position: ChrY:19761715..19761715
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17906_F TAGAGTCTAACTGTTACCCAGAGTGG
Reverse Primer: FGC17906_R ATGGCTGAAGTGACAGAAACAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies