Top » Catalog » SNPs » FGC17907

$18.00

FGC17907
[FGC17907]

FGC17907
hg38 Position: ChrY:19866311..19866311
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17906
Forward Primer: FGC17907_F AGCCAGCTTCACCTTTCAATAC
Reverse Primer: FGC17907_R TTTCAGGTTGACTTTAGAGGGC
Reviews

Customers who bought this product also purchased
S1026
S1026
FGC17866
FGC17866
Z39589
Z39589
CTS1751
CTS1751
FGC17938
FGC17938
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies