Top » Catalog » SNPs » FGC17907

$18.00

FGC17907
[FGC17907]

FGC17907
hg38 Position: ChrY:19866311..19866311
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17906
Forward Primer: FGC17907_F AGCCAGCTTCACCTTTCAATAC
Reverse Primer: FGC17907_R TTTCAGGTTGACTTTAGAGGGC
Reviews

Customers who bought this product also purchased
DYS490
DYS490
DF41
DF41
Z16500
Z16500
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC41747
FGC41747
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies