Top » Catalog » SNPs » FGC17980

$18.00

FGC17980
[FGC17980]

FGC17980
hg38 Position: ChrY:8364830..8364830
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17980_F CCACCCTCAAACAACTATTCAG
Reverse Primer: FGC17980_R GGCATATGATGCCTTGTTGC
Reviews

Customers who bought this product also purchased
FGC17986
FGC17986
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17993
FGC17993
S1047
S1047
FGC17983
FGC17983
FGC17991
FGC17991
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies