Top » Catalog » SNPs » FGC17981

$18.00

FGC17981
[FGC17981]

FGC17981
hg38 Position: ChrY:8613552..8613552
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17981_F GCATTCTGCAGGATTCTTCAG
Reverse Primer: FGC17981_R GAAGCACTGAAGTGCATAGCC
Reviews

Customers who bought this product also purchased
FGC18002
FGC18002
S1051
S1051
S1048
S1048
FGC17986
FGC17986
FGC17993
FGC17993
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies