Top » Catalog » SNPs » FGC17981

$18.00

FGC17981
[FGC17981]

FGC17981
hg38 Position: ChrY:8613552..8613552
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17981_F GCATTCTGCAGGATTCTTCAG
Reverse Primer: FGC17981_R GAAGCACTGAAGTGCATAGCC
Reviews

Customers who bought this product also purchased
FGC17980
FGC17980
FGC17988
FGC17988
S1050
S1050
S1057
S1057
FGC17987
FGC17987
FGC18002
FGC18002
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies