Top » Catalog » SNPs » FGC17982

$18.00

FGC17982
[FGC17982]

FGC17982
hg38 Position: ChrY:19193709..19193709
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17982_F AGGTCCAGGTGCAGTGACTC
Reverse Primer: FGC17982_R GCAGTGTGTAAGTGTTCAGATGG
Reviews

Customers who bought this product also purchased
S1048
S1048
FGC17986
FGC17986
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17993
FGC17993
S1047
S1047
FGC17983
FGC17983
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies