Top » Catalog » SNPs » FGC17983

$18.00

FGC17983
[FGC17983]

FGC17983
hg38 Position: ChrY:20365893..20365893
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1050 > S1047
Forward Primer: FGC17983_F TGGAGCTATAAATTGAAAAATGTTG
Reverse Primer: FGC17983_R CTGAAGGCAGGGTCTTGTTC
Reviews

Customers who bought this product also purchased
S16264
S16264
Z16500
Z16500
MC14
MC14
DF21
DF21
DF41
DF41
CTS3386
CTS3386
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies