Top » Catalog » SNPs » FGC17987

$18.00

FGC17987
[FGC17987]

FGC17987
hg38 Position: ChrY:19272884..19272884
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17987_F CTACTGATAAAGACATACTCAACTTTGC
Reverse Primer: FGC17987_R CTGAAATGAGTTAAGACGGTGGA
Reviews

Customers who bought this product also purchased
S1051
S1051
FGC18002
FGC18002
S1048
S1048
FGC17983
FGC17983
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17993
FGC17993
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies