Top » Catalog » SNPs » FGC17987

$18.00

FGC17987
[FGC17987]

FGC17987
hg38 Position: ChrY:19272884..19272884
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17987_F CTACTGATAAAGACATACTCAACTTTGC
Reverse Primer: FGC17987_R CTGAAATGAGTTAAGACGGTGGA
Reviews

Customers who bought this product also purchased
S1050
S1050
S1057
S1057
FGC17986
FGC17986
S1051
S1051
FGC18002
FGC18002
S1048
S1048
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies