Top » Catalog » SNPs » FGC17990

$18.00

FGC17990
[FGC17990]

FGC17990
hg38 Position: ChrY:20528069..20528069
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17990_F CAATGAATCTTGAGTCCCTAGAAAG
Reverse Primer: FGC17990_R GAACCACCCCATTTCATCTC
Reviews

Customers who bought this product also purchased
FGC17983
FGC17983
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17993
FGC17993
S1047
S1047
FGC17982
FGC17982
FGC17991
FGC17991
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies