Top » Catalog » SNPs » FGC17990

$18.00

FGC17990
[FGC17990]

FGC17990
hg38 Position: ChrY:20528069..20528069
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17990_F CAATGAATCTTGAGTCCCTAGAAAG
Reverse Primer: FGC17990_R GAACCACCCCATTTCATCTC
Reviews

Customers who bought this product also purchased
S1041
S1041
FGC17980
FGC17980
FGC17987
FGC17987
S1050
S1050
S1057
S1057
FGC17986
FGC17986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies