Top » Catalog » SNPs » FGC17990

$18.00

FGC17990
[FGC17990]

FGC17990
hg38 Position: ChrY:20528069..20528069
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17990_F CAATGAATCTTGAGTCCCTAGAAAG
Reverse Primer: FGC17990_R GAACCACCCCATTTCATCTC
Reviews

Customers who bought this product also purchased
FGC17982
FGC17982
FGC17991
FGC17991
S1046
S1046
FGC17981
FGC17981
FGC17988
FGC17988
S1041
S1041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies