Top » Catalog » SNPs » FGC4183

$18.00

FGC4183
[FGC4183]

FGC4183
hg38 Position: ChrY:11529445..11529445
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka S14469. Below U152 > L2
Forward Primer: FGC4183_F TCGAATGGAGTTAATTTGAATAGAGAG
Reverse Primer: FGC4183_R TCCATTCCATTTGGATACATTG
Reviews

Customers who bought this product also purchased
BY169025
BY169025
BY171286
BY171286
BY38635
BY38635
BY25318
BY25318
FT410015
FT410015
BY25320
BY25320
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies