Top » Catalog » SNPs » FGC17991

$18.00

FGC17991
[FGC17991]

FGC17991
hg38 Position: ChrY:19934203..19934203
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17991_F AATAACAGACATTCATGATGAAAGC
Reverse Primer: FGC17991_R CTTGTGTTTGTTGGGGACAG
Reviews

Customers who bought this product also purchased
S1047
S1047
FGC17982
FGC17982
FGC17990
FGC17990
S1046
S1046
FGC17981
FGC17981
FGC17988
FGC17988
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies