Top » Catalog » SNPs » FGC17991

$18.00

FGC17991
[FGC17991]

FGC17991
hg38 Position: ChrY:19934203..19934203
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17991_F AATAACAGACATTCATGATGAAAGC
Reverse Primer: FGC17991_R CTTGTGTTTGTTGGGGACAG
Reviews

Customers who bought this product also purchased
FGC17981
FGC17981
FGC17988
FGC17988
S1041
S1041
FGC17980
FGC17980
FGC17987
FGC17987
S1050
S1050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies