Top » Catalog » SNPs » FGC17993

$18.00

FGC17993
[FGC17993]

FGC17993
hg38 Position: ChrY:19289754..19289754
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC17993_F AAAAACTGGGAGCTAAATCAGG
Reverse Primer: FGC17993_R CAACTGAAAGCATGCAAACC
Reviews

Customers who bought this product also purchased
FGC17980
FGC17980
FGC17987
FGC17987
S1050
S1050
S1057
S1057
FGC17986
FGC17986
S1051
S1051
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies