Top » Catalog » SNPs » FGC18002

$18.00

FGC18002
[FGC18002]

FGC18002
hg38 Position: ChrY:8765073..8765073
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC18002_F CTCATGGGTGCAGATGAAGC
Reverse Primer: FGC18002_R CTGGATGGGACTGCAGTG
Reviews

Customers who bought this product also purchased
FGC17983
FGC17983
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17991
FGC17991
S1047
S1047
FGC17982
FGC17982
FGC17990
FGC17990
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies